Virus:Article Title: Deep scRNA sequencing reveals a broadly applicable Regeneration Classifier and implicates antioxidant response in corticospinal axon regeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti-Rat secondary antibody Alexa 488 Thermo Fisher Scientific Cat# A-11006; RRID: AB_2534074 Rat anti mouse GFAP Thermo Fisher Scientific Cat# 130300; RRID: AB_2532994 Bacterial and virus strains AAV/retro-CAG-CRE-WPRE Boston Children’s Hospital N/A AAV/retro-CAG-GFP-WPRE Boston Children’s Hospital N/A AAV2.CAG-CRE-WPRE Boston Children’s Hospital N/A Biological samples Normal Horse Serum Vector Laboratories Cat# S-2000 Triton X-100 Bio-Rad Cat# 1610407 Cryo OCT Fisher scientific Cat# 1437365 Critical commercial assays Biotinylated Dextran, 10,000 MW, Thermo Fisher Scientific Cat# D1956 Superscript III Thermo Fisher Scientific Cat# 18080085 MEGAscript T7 Transcription Kit Thermo Fisher Scientific Cat# AMB13345 RNasin (Promega) From VWR VWR Cat# PAN2515 Clean XP Beads Beckman Coulter Cat# A63987 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# RS-122-2101 AMPure Beads Beckman Coulter Cat# A63881 Superscript II Thermo Fisher Scientific Cat# 18064071 TSA Vivid Fluorophore Kit 520 Biotechne Cat# 7523 TSA Vivid Fluorophore Kit 570 Biotechne Cat# 7526 TSA Plus Fluorescein System Perkin Elmer Cat# NEL741001KT VECTASTAIN Elite ABC-HRP Kit Vector Laboratory Cat# PK-6100 Deposited data Single cell sequencing data This paper GEO: GSE205769 Mendeley data for histology This paper Mendeley Data: Experimental models: Organisms/strains Mouse: PTENf, B6.129S4-Ptentm1Hwu/J The Jackson Laboratory Strain#: 006440 Mouse: SOCS3f, B6129S4Socs3tm1Ayos/J The Jackson Laboratory Strain#: 010944 Mouse: tdTomato, B6.Cg-Gt(ROSA)26Sortm14(CAGtdTomato)Hze/J The Jackson Laboratory Strain#: 007914 Mouse:NFE2L2f, C57BL6Nfe2l2tm1.1SredSbisJ The Jackson Laboratory Strain#: 025433 Oligonucleotides dT-T7 oligo: GGAGGCCGGAGAATTGT AATACGACTCACTATAGGGAGACGC GTGTTTTTTTTTTTTTTTTTTTTTTTTV Li and Eberwine88 N/A PTEN Forward: CAAGCACTCTGCGAACTGAG The Jackson Laboratory Strain#: 006440 PTEN Reverse: AAGTTTTTGAAGGCAAGATGC The Jackson Laboratory Strain#: 006440 (Continued on next page) e1 Neuron 111, 3953–3969.e1–e5, December 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER SOCS3 Forward: CGGGCAGGGGAAGAGACTGT The Jackson Laboratory Strain#: 010944 SOCS3 Reverse: GGAGCCAGCGTGGATCTGC Geoffroy et al.89 N/A ROSA26 Forward: AGGGAGCTGCAGTGGAGTA The Jackson Laboratory Strain#: 007914 ROSA26 Reverse: CCGAAAATCTGTGGGAAGTC The Jackson Laboratory Strain#: 007914 tdTomato Forward: CTGTTCCTGTACGGCATGG The Jackson Laboratory Strain#: 007914 WPRE Reverse: GGCATTAAAGCAGCGTATCC The Jackson Laboratory Strain#: 007914 NFE2L2 Forward: TCATGAGAGCTTCCCAGACTC The Jackson Laboratory Strain#: 025433 NFE2L2 Reverse: CAGCCAGCTGCTTGTTTTC The Jackson Laboratory Strain#: 025433 Recombinant DNA RNAscope Probe - Mm-Nfe2l2 - musculus nuclear factor erythroid derived 2 like 2 (Nfe2l2) transcript variant 1 mRNA Biotechne Cat# 475571 RNAscope Probe - Mm-Bcl11b-C3 - Mus musculus B cell leukemia/lymphoma 11B (Bcl11b) transcript variant 2 mRNA Biotechne Cat# 413271-C3 Random Primers (Promega) From VWR VWR Cat# PAC1181 Software and algorithms Codes for data processing including the application package for Regeneration Classifier This paper GitHub: https://github.com/neurohugo/ SingleCellPatchseqAnalysis Zen Blue Zeiss N/A R 3.6.2 R project https://www.r-project.org/ STAR 2.7.10b Dobin et al.90 https://github.com/alexdobin/STAR Samtools Li et al.91 http://www.htslib.org/ Htseq Putri et al.92 https://htseq.readthedocs.io/en/master/ DESeq2 Love et al.93 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html EdgeR Robinson et al.94 https://bioconductor.org/packages/ release/bioc/html/edgeR.html Ingenuity Pathway analysis Qiagen https://digitalinsights.qiagen.com/ products-overview/discovery-insightsportfolio/analysis-and-visualization/ qiagen-ipa/ Seurat 2.3.4 / 4.0 Butler et al.95 https://satijalab.org/seurat/ Garnett Pliner et al.26 https://cole-trapnell-lab.github.io/garnett/ scRNAseq Bioconductor https://bioconductor.org/packages/ release/data/experiment/html/ scRNAseq.html SingleR Aran et al.23 https://www.nature.com/articles/s41590- 018-0276-y Scater McCarthy et al.96 https://bioconductor.org/packages/ release/bioc/html/scuttle.html Panther Gene ontology Ashburner et al.97 http://geneontology.org/ ImageJ 2.9.0 Schneider et al.98 https://github.com/imagej/imagej1 (Continued on next page) Neuron 111, 3953–3969.e1–e5, December 20, 2023 e2
Bioprocessing:Article Title: Deep scRNA sequencing reveals a broadly applicable Regeneration Classifier and implicates antioxidant response in corticospinal axon regeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti-Rat secondary antibody Alexa 488 Thermo Fisher Scientific Cat# A-11006; RRID: AB_2534074 Rat anti mouse GFAP Thermo Fisher Scientific Cat# 130300; RRID: AB_2532994 Bacterial and virus strains AAV/retro-CAG-CRE-WPRE Boston Children’s Hospital N/A AAV/retro-CAG-GFP-WPRE Boston Children’s Hospital N/A AAV2.CAG-CRE-WPRE Boston Children’s Hospital N/A Biological samples Normal Horse Serum Vector Laboratories Cat# S-2000 Triton X-100 Bio-Rad Cat# 1610407 Cryo OCT Fisher scientific Cat# 1437365 Critical commercial assays Biotinylated Dextran, 10,000 MW, Thermo Fisher Scientific Cat# D1956 Superscript III Thermo Fisher Scientific Cat# 18080085 MEGAscript T7 Transcription Kit Thermo Fisher Scientific Cat# AMB13345 RNasin (Promega) From VWR VWR Cat# PAN2515 Clean XP Beads Beckman Coulter Cat# A63987 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# RS-122-2101 AMPure Beads Beckman Coulter Cat# A63881 Superscript II Thermo Fisher Scientific Cat# 18064071 TSA Vivid Fluorophore Kit 520 Biotechne Cat# 7523 TSA Vivid Fluorophore Kit 570 Biotechne Cat# 7526 TSA Plus Fluorescein System Perkin Elmer Cat# NEL741001KT VECTASTAIN Elite ABC-HRP Kit Vector Laboratory Cat# PK-6100 Deposited data Single cell sequencing data This paper GEO: GSE205769 Mendeley data for histology This paper Mendeley Data: Experimental models: Organisms/strains Mouse: PTENf, B6.129S4-Ptentm1Hwu/J The Jackson Laboratory Strain#: 006440 Mouse: SOCS3f, B6129S4Socs3tm1Ayos/J The Jackson Laboratory Strain#: 010944 Mouse: tdTomato, B6.Cg-Gt(ROSA)26Sortm14(CAGtdTomato)Hze/J The Jackson Laboratory Strain#: 007914 Mouse:NFE2L2f, C57BL6Nfe2l2tm1.1SredSbisJ The Jackson Laboratory Strain#: 025433 Oligonucleotides dT-T7 oligo: GGAGGCCGGAGAATTGT AATACGACTCACTATAGGGAGACGC GTGTTTTTTTTTTTTTTTTTTTTTTTTV Li and Eberwine88 N/A PTEN Forward: CAAGCACTCTGCGAACTGAG The Jackson Laboratory Strain#: 006440 PTEN Reverse: AAGTTTTTGAAGGCAAGATGC The Jackson Laboratory Strain#: 006440 (Continued on next page) e1 Neuron 111, 3953–3969.e1–e5, December 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER SOCS3 Forward: CGGGCAGGGGAAGAGACTGT The Jackson Laboratory Strain#: 010944 SOCS3 Reverse: GGAGCCAGCGTGGATCTGC Geoffroy et al.89 N/A ROSA26 Forward: AGGGAGCTGCAGTGGAGTA The Jackson Laboratory Strain#: 007914 ROSA26 Reverse: CCGAAAATCTGTGGGAAGTC The Jackson Laboratory Strain#: 007914 tdTomato Forward: CTGTTCCTGTACGGCATGG The Jackson Laboratory Strain#: 007914 WPRE Reverse: GGCATTAAAGCAGCGTATCC The Jackson Laboratory Strain#: 007914 NFE2L2 Forward: TCATGAGAGCTTCCCAGACTC The Jackson Laboratory Strain#: 025433 NFE2L2 Reverse: CAGCCAGCTGCTTGTTTTC The Jackson Laboratory Strain#: 025433 Recombinant DNA RNAscope Probe - Mm-Nfe2l2 - musculus nuclear factor erythroid derived 2 like 2 (Nfe2l2) transcript variant 1 mRNA Biotechne Cat# 475571 RNAscope Probe - Mm-Bcl11b-C3 - Mus musculus B cell leukemia/lymphoma 11B (Bcl11b) transcript variant 2 mRNA Biotechne Cat# 413271-C3 Random Primers (Promega) From VWR VWR Cat# PAC1181 Software and algorithms Codes for data processing including the application package for Regeneration Classifier This paper GitHub: https://github.com/neurohugo/ SingleCellPatchseqAnalysis Zen Blue Zeiss N/A R 3.6.2 R project https://www.r-project.org/ STAR 2.7.10b Dobin et al.90 https://github.com/alexdobin/STAR Samtools Li et al.91 http://www.htslib.org/ Htseq Putri et al.92 https://htseq.readthedocs.io/en/master/ DESeq2 Love et al.93 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html EdgeR Robinson et al.94 https://bioconductor.org/packages/ release/bioc/html/edgeR.html Ingenuity Pathway analysis Qiagen https://digitalinsights.qiagen.com/ products-overview/discovery-insightsportfolio/analysis-and-visualization/ qiagen-ipa/ Seurat 2.3.4 / 4.0 Butler et al.95 https://satijalab.org/seurat/ Garnett Pliner et al.26 https://cole-trapnell-lab.github.io/garnett/ scRNAseq Bioconductor https://bioconductor.org/packages/ release/data/experiment/html/ scRNAseq.html SingleR Aran et al.23 https://www.nature.com/articles/s41590- 018-0276-y Scater McCarthy et al.96 https://bioconductor.org/packages/ release/bioc/html/scuttle.html Panther Gene ontology Ashburner et al.97 http://geneontology.org/ ImageJ 2.9.0 Schneider et al.98 https://github.com/imagej/imagej1 (Continued on next page) Neuron 111, 3953–3969.e1–e5, December 20, 2023 e2
Sample Prep:Article Title: Deep scRNA sequencing reveals a broadly applicable Regeneration Classifier and implicates antioxidant response in corticospinal axon regeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti-Rat secondary antibody Alexa 488 Thermo Fisher Scientific Cat# A-11006; RRID: AB_2534074 Rat anti mouse GFAP Thermo Fisher Scientific Cat# 130300; RRID: AB_2532994 Bacterial and virus strains AAV/retro-CAG-CRE-WPRE Boston Children’s Hospital N/A AAV/retro-CAG-GFP-WPRE Boston Children’s Hospital N/A AAV2.CAG-CRE-WPRE Boston Children’s Hospital N/A Biological samples Normal Horse Serum Vector Laboratories Cat# S-2000 Triton X-100 Bio-Rad Cat# 1610407 Cryo OCT Fisher scientific Cat# 1437365 Critical commercial assays Biotinylated Dextran, 10,000 MW, Thermo Fisher Scientific Cat# D1956 Superscript III Thermo Fisher Scientific Cat# 18080085 MEGAscript T7 Transcription Kit Thermo Fisher Scientific Cat# AMB13345 RNasin (Promega) From VWR VWR Cat# PAN2515 Clean XP Beads Beckman Coulter Cat# A63987 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# RS-122-2101 AMPure Beads Beckman Coulter Cat# A63881 Superscript II Thermo Fisher Scientific Cat# 18064071 TSA Vivid Fluorophore Kit 520 Biotechne Cat# 7523 TSA Vivid Fluorophore Kit 570 Biotechne Cat# 7526 TSA Plus Fluorescein System Perkin Elmer Cat# NEL741001KT VECTASTAIN Elite ABC-HRP Kit Vector Laboratory Cat# PK-6100 Deposited data Single cell sequencing data This paper GEO: GSE205769 Mendeley data for histology This paper Mendeley Data: Experimental models: Organisms/strains Mouse: PTENf, B6.129S4-Ptentm1Hwu/J The Jackson Laboratory Strain#: 006440 Mouse: SOCS3f, B6129S4Socs3tm1Ayos/J The Jackson Laboratory Strain#: 010944 Mouse: tdTomato, B6.Cg-Gt(ROSA)26Sortm14(CAGtdTomato)Hze/J The Jackson Laboratory Strain#: 007914 Mouse:NFE2L2f, C57BL6Nfe2l2tm1.1SredSbisJ The Jackson Laboratory Strain#: 025433 Oligonucleotides dT-T7 oligo: GGAGGCCGGAGAATTGT AATACGACTCACTATAGGGAGACGC GTGTTTTTTTTTTTTTTTTTTTTTTTTV Li and Eberwine88 N/A PTEN Forward: CAAGCACTCTGCGAACTGAG The Jackson Laboratory Strain#: 006440 PTEN Reverse: AAGTTTTTGAAGGCAAGATGC The Jackson Laboratory Strain#: 006440 (Continued on next page) e1 Neuron 111, 3953–3969.e1–e5, December 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER SOCS3 Forward: CGGGCAGGGGAAGAGACTGT The Jackson Laboratory Strain#: 010944 SOCS3 Reverse: GGAGCCAGCGTGGATCTGC Geoffroy et al.89 N/A ROSA26 Forward: AGGGAGCTGCAGTGGAGTA The Jackson Laboratory Strain#: 007914 ROSA26 Reverse: CCGAAAATCTGTGGGAAGTC The Jackson Laboratory Strain#: 007914 tdTomato Forward: CTGTTCCTGTACGGCATGG The Jackson Laboratory Strain#: 007914 WPRE Reverse: GGCATTAAAGCAGCGTATCC The Jackson Laboratory Strain#: 007914 NFE2L2 Forward: TCATGAGAGCTTCCCAGACTC The Jackson Laboratory Strain#: 025433 NFE2L2 Reverse: CAGCCAGCTGCTTGTTTTC The Jackson Laboratory Strain#: 025433 Recombinant DNA RNAscope Probe - Mm-Nfe2l2 - musculus nuclear factor erythroid derived 2 like 2 (Nfe2l2) transcript variant 1 mRNA Biotechne Cat# 475571 RNAscope Probe - Mm-Bcl11b-C3 - Mus musculus B cell leukemia/lymphoma 11B (Bcl11b) transcript variant 2 mRNA Biotechne Cat# 413271-C3 Random Primers (Promega) From VWR VWR Cat# PAC1181 Software and algorithms Codes for data processing including the application package for Regeneration Classifier This paper GitHub: https://github.com/neurohugo/ SingleCellPatchseqAnalysis Zen Blue Zeiss N/A R 3.6.2 R project https://www.r-project.org/ STAR 2.7.10b Dobin et al.90 https://github.com/alexdobin/STAR Samtools Li et al.91 http://www.htslib.org/ Htseq Putri et al.92 https://htseq.readthedocs.io/en/master/ DESeq2 Love et al.93 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html EdgeR Robinson et al.94 https://bioconductor.org/packages/ release/bioc/html/edgeR.html Ingenuity Pathway analysis Qiagen https://digitalinsights.qiagen.com/ products-overview/discovery-insightsportfolio/analysis-and-visualization/ qiagen-ipa/ Seurat 2.3.4 / 4.0 Butler et al.95 https://satijalab.org/seurat/ Garnett Pliner et al.26 https://cole-trapnell-lab.github.io/garnett/ scRNAseq Bioconductor https://bioconductor.org/packages/ release/data/experiment/html/ scRNAseq.html SingleR Aran et al.23 https://www.nature.com/articles/s41590- 018-0276-y Scater McCarthy et al.96 https://bioconductor.org/packages/ release/bioc/html/scuttle.html Panther Gene ontology Ashburner et al.97 http://geneontology.org/ ImageJ 2.9.0 Schneider et al.98 https://github.com/imagej/imagej1 (Continued on next page) Neuron 111, 3953–3969.e1–e5, December 20, 2023 e2
Single Cell:Article Title: Deep scRNA sequencing reveals a broadly applicable Regeneration Classifier and implicates antioxidant response in corticospinal axon regeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti-Rat secondary antibody Alexa 488 Thermo Fisher Scientific Cat# A-11006; RRID: AB_2534074 Rat anti mouse GFAP Thermo Fisher Scientific Cat# 130300; RRID: AB_2532994 Bacterial and virus strains AAV/retro-CAG-CRE-WPRE Boston Children’s Hospital N/A AAV/retro-CAG-GFP-WPRE Boston Children’s Hospital N/A AAV2.CAG-CRE-WPRE Boston Children’s Hospital N/A Biological samples Normal Horse Serum Vector Laboratories Cat# S-2000 Triton X-100 Bio-Rad Cat# 1610407 Cryo OCT Fisher scientific Cat# 1437365 Critical commercial assays Biotinylated Dextran, 10,000 MW, Thermo Fisher Scientific Cat# D1956 Superscript III Thermo Fisher Scientific Cat# 18080085 MEGAscript T7 Transcription Kit Thermo Fisher Scientific Cat# AMB13345 RNasin (Promega) From VWR VWR Cat# PAN2515 Clean XP Beads Beckman Coulter Cat# A63987 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# RS-122-2101 AMPure Beads Beckman Coulter Cat# A63881 Superscript II Thermo Fisher Scientific Cat# 18064071 TSA Vivid Fluorophore Kit 520 Biotechne Cat# 7523 TSA Vivid Fluorophore Kit 570 Biotechne Cat# 7526 TSA Plus Fluorescein System Perkin Elmer Cat# NEL741001KT VECTASTAIN Elite ABC-HRP Kit Vector Laboratory Cat# PK-6100 Deposited data Single cell sequencing data This paper GEO: GSE205769 Mendeley data for histology This paper Mendeley Data: Experimental models: Organisms/strains Mouse: PTENf, B6.129S4-Ptentm1Hwu/J The Jackson Laboratory Strain#: 006440 Mouse: SOCS3f, B6129S4Socs3tm1Ayos/J The Jackson Laboratory Strain#: 010944 Mouse: tdTomato, B6.Cg-Gt(ROSA)26Sortm14(CAGtdTomato)Hze/J The Jackson Laboratory Strain#: 007914 Mouse:NFE2L2f, C57BL6Nfe2l2tm1.1SredSbisJ The Jackson Laboratory Strain#: 025433 Oligonucleotides dT-T7 oligo: GGAGGCCGGAGAATTGT AATACGACTCACTATAGGGAGACGC GTGTTTTTTTTTTTTTTTTTTTTTTTTV Li and Eberwine88 N/A PTEN Forward: CAAGCACTCTGCGAACTGAG The Jackson Laboratory Strain#: 006440 PTEN Reverse: AAGTTTTTGAAGGCAAGATGC The Jackson Laboratory Strain#: 006440 (Continued on next page) e1 Neuron 111, 3953–3969.e1–e5, December 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER SOCS3 Forward: CGGGCAGGGGAAGAGACTGT The Jackson Laboratory Strain#: 010944 SOCS3 Reverse: GGAGCCAGCGTGGATCTGC Geoffroy et al.89 N/A ROSA26 Forward: AGGGAGCTGCAGTGGAGTA The Jackson Laboratory Strain#: 007914 ROSA26 Reverse: CCGAAAATCTGTGGGAAGTC The Jackson Laboratory Strain#: 007914 tdTomato Forward: CTGTTCCTGTACGGCATGG The Jackson Laboratory Strain#: 007914 WPRE Reverse: GGCATTAAAGCAGCGTATCC The Jackson Laboratory Strain#: 007914 NFE2L2 Forward: TCATGAGAGCTTCCCAGACTC The Jackson Laboratory Strain#: 025433 NFE2L2 Reverse: CAGCCAGCTGCTTGTTTTC The Jackson Laboratory Strain#: 025433 Recombinant DNA RNAscope Probe - Mm-Nfe2l2 - musculus nuclear factor erythroid derived 2 like 2 (Nfe2l2) transcript variant 1 mRNA Biotechne Cat# 475571 RNAscope Probe - Mm-Bcl11b-C3 - Mus musculus B cell leukemia/lymphoma 11B (Bcl11b) transcript variant 2 mRNA Biotechne Cat# 413271-C3 Random Primers (Promega) From VWR VWR Cat# PAC1181 Software and algorithms Codes for data processing including the application package for Regeneration Classifier This paper GitHub: https://github.com/neurohugo/ SingleCellPatchseqAnalysis Zen Blue Zeiss N/A R 3.6.2 R project https://www.r-project.org/ STAR 2.7.10b Dobin et al.90 https://github.com/alexdobin/STAR Samtools Li et al.91 http://www.htslib.org/ Htseq Putri et al.92 https://htseq.readthedocs.io/en/master/ DESeq2 Love et al.93 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html EdgeR Robinson et al.94 https://bioconductor.org/packages/ release/bioc/html/edgeR.html Ingenuity Pathway analysis Qiagen https://digitalinsights.qiagen.com/ products-overview/discovery-insightsportfolio/analysis-and-visualization/ qiagen-ipa/ Seurat 2.3.4 / 4.0 Butler et al.95 https://satijalab.org/seurat/ Garnett Pliner et al.26 https://cole-trapnell-lab.github.io/garnett/ scRNAseq Bioconductor https://bioconductor.org/packages/ release/data/experiment/html/ scRNAseq.html SingleR Aran et al.23 https://www.nature.com/articles/s41590- 018-0276-y Scater McCarthy et al.96 https://bioconductor.org/packages/ release/bioc/html/scuttle.html Panther Gene ontology Ashburner et al.97 http://geneontology.org/ ImageJ 2.9.0 Schneider et al.98 https://github.com/imagej/imagej1 (Continued on next page) Neuron 111, 3953–3969.e1–e5, December 20, 2023 e2
Sequencing:Article Title: Deep scRNA sequencing reveals a broadly applicable Regeneration Classifier and implicates antioxidant response in corticospinal axon regeneration.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Goat anti-Rat secondary antibody Alexa 488 Thermo Fisher Scientific Cat# A-11006; RRID: AB_2534074 Rat anti mouse GFAP Thermo Fisher Scientific Cat# 130300; RRID: AB_2532994 Bacterial and virus strains AAV/retro-CAG-CRE-WPRE Boston Children’s Hospital N/A AAV/retro-CAG-GFP-WPRE Boston Children’s Hospital N/A AAV2.CAG-CRE-WPRE Boston Children’s Hospital N/A Biological samples Normal Horse Serum Vector Laboratories Cat# S-2000 Triton X-100 Bio-Rad Cat# 1610407 Cryo OCT Fisher scientific Cat# 1437365 Critical commercial assays Biotinylated Dextran, 10,000 MW, Thermo Fisher Scientific Cat# D1956 Superscript III Thermo Fisher Scientific Cat# 18080085 MEGAscript T7 Transcription Kit Thermo Fisher Scientific Cat# AMB13345 RNasin (Promega) From VWR VWR Cat# PAN2515 Clean XP Beads Beckman Coulter Cat# A63987 TruSeq Stranded mRNA Sample Prep Kit Illumina Cat# RS-122-2101 AMPure Beads Beckman Coulter Cat# A63881 Superscript II Thermo Fisher Scientific Cat# 18064071 TSA Vivid Fluorophore Kit 520 Biotechne Cat# 7523 TSA Vivid Fluorophore Kit 570 Biotechne Cat# 7526 TSA Plus Fluorescein System Perkin Elmer Cat# NEL741001KT VECTASTAIN Elite ABC-HRP Kit Vector Laboratory Cat# PK-6100 Deposited data Single cell sequencing data This paper GEO: GSE205769 Mendeley data for histology This paper Mendeley Data: Experimental models: Organisms/strains Mouse: PTENf, B6.129S4-Ptentm1Hwu/J The Jackson Laboratory Strain#: 006440 Mouse: SOCS3f, B6129S4Socs3tm1Ayos/J The Jackson Laboratory Strain#: 010944 Mouse: tdTomato, B6.Cg-Gt(ROSA)26Sortm14(CAGtdTomato)Hze/J The Jackson Laboratory Strain#: 007914 Mouse:NFE2L2f, C57BL6Nfe2l2tm1.1SredSbisJ The Jackson Laboratory Strain#: 025433 Oligonucleotides dT-T7 oligo: GGAGGCCGGAGAATTGT AATACGACTCACTATAGGGAGACGC GTGTTTTTTTTTTTTTTTTTTTTTTTTV Li and Eberwine88 N/A PTEN Forward: CAAGCACTCTGCGAACTGAG The Jackson Laboratory Strain#: 006440 PTEN Reverse: AAGTTTTTGAAGGCAAGATGC The Jackson Laboratory Strain#: 006440 (Continued on next page) e1 Neuron 111, 3953–3969.e1–e5, December 20, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER SOCS3 Forward: CGGGCAGGGGAAGAGACTGT The Jackson Laboratory Strain#: 010944 SOCS3 Reverse: GGAGCCAGCGTGGATCTGC Geoffroy et al.89 N/A ROSA26 Forward: AGGGAGCTGCAGTGGAGTA The Jackson Laboratory Strain#: 007914 ROSA26 Reverse: CCGAAAATCTGTGGGAAGTC The Jackson Laboratory Strain#: 007914 tdTomato Forward: CTGTTCCTGTACGGCATGG The Jackson Laboratory Strain#: 007914 WPRE Reverse: GGCATTAAAGCAGCGTATCC The Jackson Laboratory Strain#: 007914 NFE2L2 Forward: TCATGAGAGCTTCCCAGACTC The Jackson Laboratory Strain#: 025433 NFE2L2 Reverse: CAGCCAGCTGCTTGTTTTC The Jackson Laboratory Strain#: 025433 Recombinant DNA RNAscope Probe - Mm-Nfe2l2 - musculus nuclear factor erythroid derived 2 like 2 (Nfe2l2) transcript variant 1 mRNA Biotechne Cat# 475571 RNAscope Probe - Mm-Bcl11b-C3 - Mus musculus B cell leukemia/lymphoma 11B (Bcl11b) transcript variant 2 mRNA Biotechne Cat# 413271-C3 Random Primers (Promega) From VWR VWR Cat# PAC1181 Software and algorithms Codes for data processing including the application package for Regeneration Classifier This paper GitHub: https://github.com/neurohugo/ SingleCellPatchseqAnalysis Zen Blue Zeiss N/A R 3.6.2 R project https://www.r-project.org/ STAR 2.7.10b Dobin et al.90 https://github.com/alexdobin/STAR Samtools Li et al.91 http://www.htslib.org/ Htseq Putri et al.92 https://htseq.readthedocs.io/en/master/ DESeq2 Love et al.93 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html EdgeR Robinson et al.94 https://bioconductor.org/packages/ release/bioc/html/edgeR.html Ingenuity Pathway analysis Qiagen https://digitalinsights.qiagen.com/ products-overview/discovery-insightsportfolio/analysis-and-visualization/ qiagen-ipa/ Seurat 2.3.4 / 4.0 Butler et al.95 https://satijalab.org/seurat/ Garnett Pliner et al.26 https://cole-trapnell-lab.github.io/garnett/ scRNAseq Bioconductor https://bioconductor.org/packages/ release/data/experiment/html/ scRNAseq.html SingleR Aran et al.23 https://www.nature.com/articles/s41590- 018-0276-y Scater McCarthy et al.96 https://bioconductor.org/packages/ release/bioc/html/scuttle.html Panther Gene ontology Ashburner et al.97 http://geneontology.org/ ImageJ 2.9.0 Schneider et al.98 https://github.com/imagej/imagej1 (Continued on next page) Neuron 111, 3953–3969.e1–e5, December 20, 2023 e2
RNAscope:Article Title: Deep RNA-seq of male and female murine sensory neuron subtypes after nerve injury.
Article Snippet: .. Reagent Source Identifier Dilution Donkey anti-Mouse IgG (H1L), Alexa Fluor 488 ThermoFisher Scientific A-21202 1/200 Donkey anti-Rabbit IgG (H1L), Alexa Fluor 546 ThermoFisher Scientific A10040 1/200 Donkey anti-Sheep IgG (H1L), Alexa Fluor 488 ThermoFisher Scientific A-11015 1/200 Donkey anti-Sheep IgG (H1L), Alexa Fluor 546 ThermoFisher Scientific A-21098 1/200 Goat anti-Chicken IgY (H1L), Alexa Fluor 546 ThermoFisher Scientific A-11040 1/200 Goat anti-Rabbit IgG (H1L), Alexa Fluor 488 ThermoFisher Scientific A-11008 1/200 Goat anti-Rabbit IgG (H1L), Alexa Fluor 546 ThermoFisher Scientific A-11010 1/200 Goat anti-Rabbit IgG (H1L), Pacific Blue ThermoFisher Scientific P-10994 1/200 Streptavidin, Pacific Blue conjugate ThermoFisher Scientific S11222 1/100 anti-CGRP, rabbit Peninsular Labs T4032 1/500 anti-CGRP, sheep Enzo Ca1137 1/250-1/500 anti-Glutamine synthetase (GS), rabbit Sigma-Aldrich G2781 1/500 anti-NeuN, chicken Merck Millipore Abn91 1/500 anti-NeuN, rabbit Abcam Ab177487 1/500 anti-NF200, mouse Sigma-Aldrich N0142 1/250 anti-NF200, rabbit Merck Millipore ABN76 1/1000 anti-Parvalbumin (PV), guinea pig Frontier Institute Af1000 1/200-1/500 anti-Tyrosine Hydroxylase (TH), sheep Merck Millipore Ab1542 1/400 IB4, streptavidin conjugated Sigma-Aldrich L2140 1/100 mm-Ntrk2-C2 ACDBio 423611-C2 1/50 mm-Kcnj11 ACDBio 431451 NA mm-Kcns1 ACDBio 525941 NA mm-Cacng2 ACDBio 437221 NA RNAscope Multiplex Fluorescent Reagent Kit v1 ACDBio 320293 NA RNAscope Multiplex Fluorescent Reagent Kit v2 ACDBio 323100 NA TSA Vivid Fluorophore kit 570 Biotechne 7526/1 1/1500 TSA Vivid Fluorophore kit 520 Biotechne 7523/1 1/1500 D ow nloaded from http://journals.lw w .com /pain by B hD M f5eP H K av1zE oum 1tQ fN 4a+ kJLhE Z gbsIH o4X M i0hC yw C X 1A W nY Q p/IlQ rH D 3i3D 0O dR yi7T vS F l4C f3V C 4/O A V pD D a8K 2+ Y a6H 515kE = on 01/26/2024 Figure 1. ..
Multiplex Assay:Article Title: Deep RNA-seq of male and female murine sensory neuron subtypes after nerve injury.
Article Snippet: .. Reagent Source Identifier Dilution Donkey anti-Mouse IgG (H1L), Alexa Fluor 488 ThermoFisher Scientific A-21202 1/200 Donkey anti-Rabbit IgG (H1L), Alexa Fluor 546 ThermoFisher Scientific A10040 1/200 Donkey anti-Sheep IgG (H1L), Alexa Fluor 488 ThermoFisher Scientific A-11015 1/200 Donkey anti-Sheep IgG (H1L), Alexa Fluor 546 ThermoFisher Scientific A-21098 1/200 Goat anti-Chicken IgY (H1L), Alexa Fluor 546 ThermoFisher Scientific A-11040 1/200 Goat anti-Rabbit IgG (H1L), Alexa Fluor 488 ThermoFisher Scientific A-11008 1/200 Goat anti-Rabbit IgG (H1L), Alexa Fluor 546 ThermoFisher Scientific A-11010 1/200 Goat anti-Rabbit IgG (H1L), Pacific Blue ThermoFisher Scientific P-10994 1/200 Streptavidin, Pacific Blue conjugate ThermoFisher Scientific S11222 1/100 anti-CGRP, rabbit Peninsular Labs T4032 1/500 anti-CGRP, sheep Enzo Ca1137 1/250-1/500 anti-Glutamine synthetase (GS), rabbit Sigma-Aldrich G2781 1/500 anti-NeuN, chicken Merck Millipore Abn91 1/500 anti-NeuN, rabbit Abcam Ab177487 1/500 anti-NF200, mouse Sigma-Aldrich N0142 1/250 anti-NF200, rabbit Merck Millipore ABN76 1/1000 anti-Parvalbumin (PV), guinea pig Frontier Institute Af1000 1/200-1/500 anti-Tyrosine Hydroxylase (TH), sheep Merck Millipore Ab1542 1/400 IB4, streptavidin conjugated Sigma-Aldrich L2140 1/100 mm-Ntrk2-C2 ACDBio 423611-C2 1/50 mm-Kcnj11 ACDBio 431451 NA mm-Kcns1 ACDBio 525941 NA mm-Cacng2 ACDBio 437221 NA RNAscope Multiplex Fluorescent Reagent Kit v1 ACDBio 320293 NA RNAscope Multiplex Fluorescent Reagent Kit v2 ACDBio 323100 NA TSA Vivid Fluorophore kit 570 Biotechne 7526/1 1/1500 TSA Vivid Fluorophore kit 520 Biotechne 7523/1 1/1500 D ow nloaded from http://journals.lw w .com /pain by B hD M f5eP H K av1zE oum 1tQ fN 4a+ kJLhE Z gbsIH o4X M i0hC yw C X 1A W nY Q p/IlQ rH D 3i3D 0O dR yi7T vS F l4C f3V C 4/O A V pD D a8K 2+ Y a6H 515kE = on 01/26/2024 Figure 1. ..
|